Top » Catalog » SNPs » A656

$18.00

A656
[A656]

A656
hg38 Position: ChrY:19624008..19624008
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A656_F CCAGACAAATGAAAGCTGAGG
Reverse Primer: A656_R GCATAAACAATCATGCAAAAAGTAG
Reviews

Customers who bought this product also purchased
BY20443
BY20443
BY152300
BY152300
BY153784
BY153784
A5870
A5870
DF98
DF98
BY5719
BY5719
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies