Top » Catalog » SNPs » A589

$18.00

A589
[A589]

A589
hg38 Position: ChrY:13737775..13737775
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A589_F CAACTGAACCTCCCCTATGTG
Reverse Primer: A589_R TAAGGCAAAGCGGTACACG
Reviews

Customers who bought this product also purchased
R1b-Z30 downstream
R1b-Z30 downstream
A592
A592
A599
A599
A591
A591
A597
A597
A590
A590
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies