Top » Catalog » SNPs » A636

$18.00

A636
[A636]

A636
hg38 Position: ChrY:19017216..19017216
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of CTS6889 / CTS11824
Forward Primer: A636_F GCCACACAATAATCCTCATGC
Reverse Primer: A636_R AAGTGATGGCAGCTCATGC
Reviews

Customers who bought this product also purchased
Y21240
Y21240
U152
U152
U106
U106
Y23485
Y23485
L51
L51
Y16640
Y16640
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies