Top » Catalog » SNPs » A636

$18.00

A636
[A636]

A636
hg38 Position: ChrY:19017216..19017216
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of CTS6889 / CTS11824
Forward Primer: A636_F GCCACACAATAATCCTCATGC
Reverse Primer: A636_R AAGTGATGGCAGCTCATGC
Reviews

Customers who bought this product also purchased
L151
L151
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
U106
U106
Y23485
Y23485
L51
L51
Y16640
Y16640
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies