Top » Catalog » SNPs » FGC10360

$18.00

FGC10360
[FGC10360]

FGC10360
hg38 Position: ChrY:19844922..19844922
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below Y2902, above Y3219. Aka Y3226
Forward Primer: FGC10360_F AGCTGAGGGGGCTGTTATTC
Reverse Primer: FGC10360_R CATTGTTGGCCATGGTGAG
Reviews

Customers who bought this product also purchased
BY32474
BY32474
Y35213
Y35213
YP1447
YP1447
Y35236
Y35236
YP3994
YP3994
BY65954
BY65954
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies