Top » Catalog » SNPs » A431

$18.00

A431
[A431]

A431
hg38 Position: ChrY:8595740..8595740
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2a4
Comments: Approx. DF27
Forward Primer: A431_F AACCCCTCCACTTCCAATG
Reverse Primer: A431_R CCACGGATCCCAAAGAGAAC
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M343
M343
M9
M9
Y21428
Y21428
Y14468
Y14468
BY3332
BY3332
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies