Top » Catalog » SNPs » P109

$18.00

P109
[P109]

P109
hg38 Position: ChrY:13314125..13314125
Ancestral: C
Derived: T
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: I1a1b1
Comments: UTY AluY83
Forward Primer: P109_F ATCGGTTTCGTCTGGGAAC
Reverse Primer: P109_R CCTGGCCCTTTCTTTATTTG
Reviews

Customers who bought this product also purchased
Y29628
Y29628
Y4741
Y4741
Y24054
Y24054
Y15027
Y15027
Y8598
Y8598
BY35406
BY35406
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies