Top » Catalog » SNPs » FGC3263

$18.00

FGC3263
[FGC3263]

FGC3263
hg38 Position: ChrY:19881499..19881499
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f3 (not listed)
Comments: Below PF825.2
Forward Primer: FGC3263_F TCTGGCAAGTATAAAGCCACAG
Reverse Primer: FGC3263_R CTGTGGTCCCTTTCTTTTGAG
Reviews

Customers who bought this product also purchased
FGC3259
FGC3259
PF825.2
PF825.2
FGC3250
FGC3250
L430
L430
R1b-PF825.2 downstream
R1b-PF825.2 downstream
FGC3248
FGC3248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies