Top » Catalog » SNPs » FGC19832

$18.00

FGC19832
[FGC19832]

FGC19832
hg38 Position: ChrY:8048207..8048207
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below M222 > DF105 > S603 > FGC19833
Forward Primer: FGC19832_F ATACCTCTGGGCATGTCACC
Reverse Primer: FGC19832_R GTTCATGGGTGTTGTTGAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies