Top » Catalog » SNPs » M2854

$18.00

M2854
[M2854]

M2854
hg38 Position: ChrY:13636950..13636950
Ancestral: G
Derived: C
Reference: Underhill et al.
ISOGG Haplogroup: H1a1a4b2
Comments: Below SK1225
Forward Primer: M2854v2_F GGAGATCTTTTCTGTCTGGCC
Reverse Primer: M2854v2_R TCTCACTGACTCCAGGAGTGAG
Reviews

Customers who bought this product also purchased
PH124
PH124
FT305975
FT305975
Z14437
Z14437
FGC2366
FGC2366
M96
M96
L901
L901
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies