Top » Catalog » SNPs » A748

$18.00

A748
[A748]

A748
hg38 Position: ChrY:19292956..19292956
Ancestral: A
Derived: T
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b2b
Comments: Downstream of A150
Forward Primer: A748_F GGGAGGGAATATCCTTGAGC
Reverse Primer: A748_R TTCATCAGGTTCCAGTTCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies