Top » Catalog » SNPs » A780

$19.00

A780
[A780]

A780
hg38 Position: ChrY:8995664..8995664
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: E1b1b1a1b1a6 (not listed)
Comments: Downstream L540
Forward Primer: A780_F AAAACCTATCACAATATTAGCAATAGTTATG
Reverse Primer: A780_R TCAAGTGTGAGATTCAGGAAAGG
Reviews

Customers who bought this product also purchased
A781
A781
A779
A779
A782
A782
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies