Top » Catalog » SNPs » A802

$18.00

A802
[A802]

A802
hg38 Position: ChrY:8607051..8607051
Ancestral: T
Derived: C
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4a1
Comments: Found in CTS4466 individuals downstream of S1121
Forward Primer: A802_F TGGAGGGTGTCTTTCATTGG
Reverse Primer: A802_R GCATGAACCATGACAACGTC
Reviews

Customers who bought this product also purchased
A808
A808
A804
A804
A726
A726
A664
A664
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
A542
A542
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies