Top » Catalog » SNPs » Z22636

$18.00

Z22636
[Z22636]

Z22636
hg38 Position: ChrY:8019277..8019277
Ancestral: A
Derived: G
Reference: Ray Banks (2015)
ISOGG Haplogroup: E1b1a1a1a1c1a1a3 (not listed)
Comments: below M4670, equiv to Z5976
Forward Primer: Z22636_F TCAGTGATGTATCTAATCCTCCACC
Reverse Primer: Z22636_R ACCAAGCAACTAAGTGATATACAACAC
Reviews

Customers who bought this product also purchased
CTS3274
CTS3274
U175
U175
M184
M184
CTS9387
CTS9387
M96
M96
CTS2754
CTS2754
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies