Top » Catalog » SNPs » CTS6433

$18.00

CTS6433
[CTS6433]

CTS6433
hg38 Position: ChrY:14778084..14778084
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a2a1b2a2
Comments: Syn. with CTS6433; downstream CTS2392 Z76
Forward Primer: CTS6433v2_F CCCAACTACTTGAGAGGCTAAGC
Reverse Primer: CTS6433v2_R ACTATGGAGGAACTCCTGAGGG
Reviews

Customers who bought this product also purchased
FGC3617
FGC3617
ZS3
ZS3
Y31133
Y31133
Y13434
Y13434
Y5695
Y5695
FGC19998
FGC19998
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies