Top » Catalog » SNPs » A17457

$18.00

A17457
[A17457]

A17457
hg38 Position: ChrY:15313021..15313021
Ancestral: C
Derived: T
Reference: Connie McKenzie (2017)
ISOGG Haplogroup: I2
Comments: Below Y4751 > Y12714
Forward Primer: A17457_F CGTCCACCAATGGAAAAAC
Reverse Primer: A17457_R AGAGAAAAGCGCTTGTGCAG
Reviews

Customers who bought this product also purchased
A17458
A17458
A17463
A17463
A17456
A17456
A17462
A17462
A17455
A17455
A17461
A17461
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies