Top » Catalog » SNPs » Z17615

$18.00

Z17615
[Z17615]

Z17615
hg38 Position: ChrY:8478994..8478994
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of L1335 > L1065 > PF5236
Forward Primer: Z17615_F TGGCATAAGCTGTTTTCATCC
Reverse Primer: Z17615_R TTCATTACCCAGCAACCTGAC
Reviews

Customers who bought this product also purchased
BY9586
BY9586
FGC59129
FGC59129
FGC1696
FGC1696
FGC57117
FGC57117
FGC4440
FGC4440
FGC51899
FGC51899
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies