Top » Catalog » SNPs » A19204

$18.00

A19204
[A19204]

A19204
hg38 Position: ChrY:12419639..12419639
Ancestral: C
Derived: A
Reference: Carl Oehmann (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A19204_F AGCCAGCATCTTTCTTGTGG
Reverse Primer: A19204_R CTTGAGGCCAGGACTTTGAG
Reviews

Customers who bought this product also purchased
A19205
A19205
FGC67634
FGC67634
FGC67627
FGC67627
FGC54212
FGC54212
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies