Top » Catalog » SNPs » FGC64425

$19.00

FGC64425
[FGC64425]

FGC64425
hg38 Position: ChrY:16633597..16633597
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC64425vl2_F TGAGGGAAAATACGCAGACAG
Reverse Primer: FGC64425vl2_R TGCACTGATCTTTAATTGAGCATC
Reviews

Customers who bought this product also purchased
FGC4474
FGC4474
A27566
A27566
CTS9501
CTS9501
FT254568
FT254568
M267
M267
FGC7393
FGC7393
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies