Top » Catalog » SNPs » FGC64425

$19.00

FGC64425
[FGC64425]

FGC64425
hg38 Position: ChrY:16633597..16633597
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC64425vl2_F TGAGGGAAAATACGCAGACAG
Reverse Primer: FGC64425vl2_R TGCACTGATCTTTAATTGAGCATC
Reviews

Customers who bought this product also purchased
FGC64423
FGC64423
FT79795
FT79795
FGC1
FGC1
A22922
A22922
FGC4474
FGC4474
A27566
A27566
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies