Top » Catalog » SNPs » A19111

$18.00

A19111
[A19111]

A19111
hg38 Position: ChrY:13021269..13021269
Ancestral: G
Derived: C
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19111_F TCTTTGTGGCTGTTGCAATG
Reverse Primer: A19111_R ACAGAAGCCGGAACCATTC
Reviews

Customers who bought this product also purchased
A19115
A19115
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
A19143
A19143
A19094
A19094
A19157
A19157
A19114
A19114
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies