Top » Catalog » SNPs » A19118

$18.00

A19118
[A19118]

A19118
hg38 Position: ChrY:14346557..14346557
Ancestral: A
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2a
Comments: FGC21085
Forward Primer: A19118_F TATAGCCTGGAAGCCCCATC
Reverse Primer: A19118_R AAATCCATGCATGTTCAACG
Reviews

Customers who bought this product also purchased
FGC21080
FGC21080
FGC21092
FGC21092
FGC21079
FGC21079
FGC21090
FGC21090
FGC21077
FGC21077
FGC21088
FGC21088
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies