Top » Catalog » SNPs » A19118

$18.00

A19118
[A19118]

A19118
hg38 Position: ChrY:14346557..14346557
Ancestral: A
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2a
Comments: FGC21085
Forward Primer: A19118_F TATAGCCTGGAAGCCCCATC
Reverse Primer: A19118_R AAATCCATGCATGTTCAACG
Reviews

Customers who bought this product also purchased
FGC21077
FGC21077
FGC21088
FGC21088
A19087
A19087
FGC21087
FGC21087
Y24651
Y24651
A18941
A18941
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies