Top » Catalog » SNPs » FGC11788

$18.00

FGC11788
[FGC11788]

FGC11788
hg38 Position: ChrY:7837749..7837749
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b2c1a1
Comments: downstream of L513 > S6365 > Z16385 > Z16395
Forward Primer: FGC11788_F GTGGCACGGTCTTCAGTTTG
Reverse Primer: FGC11788_R ACTTACCCAATTTTCACCGGTC
Reviews

Customers who bought this product also purchased
Z17810
Z17810
Z16388
Z16388
Z17801
Z17801
Z17809
Z17809
Z16387
Z16387
Z16396
Z16396
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies