Top » Catalog » SNPs » A909

$18.00

A909
[A909]

A909
hg38 Position: ChrY:16083184..16083184
Ancestral: T
Derived: C
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A909_F AAGCCACACCTTATCTGCAC
Reverse Primer: A909_R TCCCTTGAACCTGGGATG
Reviews

Customers who bought this product also purchased
A9010
A9010
A907
A907
A896
A896
A903
A903
A897
A897
A912
A912
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies