Top » Catalog » SNPs » BY42595

$18.00

BY42595
[BY42595]

BY42595
hg38 Position: ChrY:56887153..56887153
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: unknown
Comments: DYS655
Forward Primer: BY42595_F GCGTCCCAAGTAGCTAGGACTC
Reverse Primer: BY42595_R AATGTGGCCCATATACACCAG
Reviews

Customers who bought this product also purchased
DYS533
DYS533
YSEQ-Gamma
YSEQ-Gamma
DYS518
DYS518
DXYS156
DXYS156
DYS711
DYS711
DYS463
DYS463
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies