Top » Catalog » SNPs » A1105

$18.00

A1105
[A1105]

A1105
hg38 Position: ChrY:7986599..7986599
Ancestral: A
Derived: G
Reference: Mike Walsh (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream S1026
Forward Primer: A1105_F CTGGTGCAGCAATCATTCTC
Reverse Primer: A1105_R TTCATTGAATGTGGAGGTTTTC
Reviews

Customers who bought this product also purchased
Z56
Z56
Z16500
Z16500
L21
L21
DF49
DF49
U152
U152
S1026
S1026
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies