Top » Catalog » SNPs » S1090

$18.00

S1090
[S1090]

S1090
hg38 Position: ChrY:14985668..14985668
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of FGC5496
Forward Primer: S1090_F CAATCTACATTCAACAGGAGGAAC
Reverse Primer: S1090_R CTGTCATTCGATCACTTACTTGATTG
Reviews

Customers who bought this product also purchased
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC5496
FGC5496
DF21
DF21
A178
A178
Z255
Z255
FGC5521
FGC5521
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies