Top » Catalog » SNPs » S781

$18.00

S781
[S781]

S781
HG19 Position: ChrY:18538470..18538470
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in Stewart study
Forward Primer: S781_F TCCAAAATCAGCACTGAAGG
Reverse Primer: S781_R AGGGAAGAAGGAGAGAAATGG
Reviews (1)

Customers who bought this product also purchased
A5023
A5023
S310
S310
Y14198
Y14198
L746
L746
A919
A919
R1b-DF41 Panel (including Royal Stewart clades)
R1b-DF41 Panel (including Royal Stewart clades)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies