Top » Catalog » SNPs » S781

$18.00

S781
[S781]

S781
hg38 Position: ChrY:16426590..16426590
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i1a1
Comments: Found in Stewart study
Forward Primer: S781_F TCCAAAATCAGCACTGAAGG
Reverse Primer: S781_R AGGGAAGAAGGAGAGAAATGG
Reviews (1)

Customers who bought this product also purchased
S310
S310
A5023
A5023
Y14198
Y14198
BY114
BY114
A922
A922
A40
A40
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies