Top » Catalog » SNPs » S781

$17.50

S781
[S781]

S781
HG19 Position: ChrY:18538470..18538470
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in Stewart study
Forward Primer: S781_F TCCAAAATCAGCACTGAAGG
Reverse Primer: S781_R AGGGAAGAAGGAGAGAAATGG
Reviews (1)

Customers who bought this product also purchased
A5023
A5023
S310
S310
Y14198
Y14198
S775
S775
L746
L746
A919
A919
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies