Top » Catalog » SNPs » A1152

$18.00

A1152
[A1152]

A1152
hg38 Position: ChrY:16719215..16719215
Ancestral: C
Derived: T
Reference: Hamma Bachir (2014)
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Below M183
Forward Primer: A1152_F TTCCATGTTTGCCAAGGG
Reverse Primer: A1152_R GGCAAAGGAGAGTAGCTGGC
Reviews

Customers who bought this product also purchased
MZ215
MZ215
BY9691
BY9691
BY9745
BY9745
MZ147
MZ147
MZ90
MZ90
MZ136
MZ136
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies