Top » Catalog » SNPs » A1152

$18.00

A1152
[A1152]

A1152
hg38 Position: ChrY:16719215..16719215
Ancestral: C
Derived: T
Reference: Hamma Bachir (2014)
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Below M183
Forward Primer: A1152_F TTCCATGTTTGCCAAGGG
Reverse Primer: A1152_R GGCAAAGGAGAGTAGCTGGC
Reviews

Customers who bought this product also purchased
BY9709
BY9709
Y20079
Y20079
E Superclade Panel
E Superclade Panel
L335
L335
M267
M267
P177
P177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies