Top » Catalog » Y SNPs » M1107

$18.00

M1107
[M1107]

M1107
hg38 Position: ChrY:13090695..13090695
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: Q1a2a1 (not listed)
Comments: Below L54 & peer to L334
Forward Primer: M1107_F TTTTTGAGACAGTTTTCCTCTTG
Reverse Primer: M1107_R TGACTAAGAACAGGTTATGATAGGG
Reviews

Customers who bought this product also purchased
Z19255
Z19255
BZ2870
BZ2870
BZ4523
BZ4523
L527
L527
L932
L932
BZ4515
BZ4515
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies