Top » Catalog » SNPs » FGC12305

$18.00

FGC12305
[FGC12305]

FGC12305
hg38 Position: ChrY:17439461..17439461
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1c2a (not listed)
Comments: Downstream of DF89
Forward Primer: FGC12305v2_F CAACAGGACACAGAAGCAAATG
Reverse Primer: FGC12305v2_R GTCATACCACAAAATGCCAGG
Reviews

Customers who bought this product also purchased
P38
P38
S1194
S1194
JFS0029
JFS0029
M9
M9
Z2103
Z2103
JFS0005
JFS0005
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies