Top » Catalog » SNPs » A1313

$18.00

A1313
[A1313]

A1313
hg38 Position: ChrY:8091336..8091336
Ancestral: G
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1313_F GGACTTCAATGTTCGCTTTG
Reverse Primer: A1313_R GGTCCAGCACCCAGTAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies