Top » Catalog » SNPs » FGC4288

$18.00

FGC4288
[FGC4288]

FGC4288
hg38 Position: ChrY:14125237..14125237
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC4288v2_F GTAATTTTAAGCTATACAGTTTTAAGGCTTTG
Reverse Primer: FGC4288v2_R GACACTACAAAATGAAGCCATCTAAC
Reviews

Customers who bought this product also purchased
FGC4286
FGC4286
DNA Sample Kit
DNA Sample Kit
FGC4284
FGC4284
FGC4298
FGC4298
FGC4278
FGC4278
FGC4295
FGC4295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies