Top » Catalog » SNPs » A5

$18.00

A5
[A5]

A5
hg38 Position: ChrY:13728439..13728439
Ancestral: T
Derived: C
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a
Comments: Found in a R1b-L513 person
Forward Primer: A5_F CACTCCCACTGTTTGAATGG
Reverse Primer: A5_R ATCACTGGCCCCATTAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies