Top » Catalog » SNPs » CTS8162

$15.00

CTS8162
[CTS8162]

CTS8162
hg38 Position: ChrY:15745639..15745639
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Found in CTS4466 individual. Downstream of S1121.
Forward Primer: CTS8162v2_F TAATTTCAGATATTCTGGTATGTTGTGC
Reverse Primer: CTS8162v2_R GCATCAAGCAGACCTAATAGACAC
Reviews

Customers who bought this product also purchased
FGC29071
FGC29071
FGC29077
FGC29077
FGC29069
FGC29069
FGC29076
FGC29076
FGC29067
FGC29067
FGC29075
FGC29075
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies