Top » Catalog » SNPs » FGC29066

$15.00

FGC29066
[FGC29066]

FGC29066
hg38 Position: ChrY:7409832..7409832
Ancestral: C
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Downstream of S1121.
Forward Primer: FGC29066_F AACTACATGGAAACGGCACG
Reverse Primer: FGC29066_R AAATGTTTGCAAGACTCAATGATG
Reviews

Customers who bought this product also purchased
FGC29069
FGC29069
FGC29076
FGC29076
FGC29067
FGC29067
FGC29075
FGC29075
CTS8162
CTS8162
FGC29074
FGC29074
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies