Top » Catalog » SNPs » FGC29067

$15.00

FGC29067
[FGC29067]

FGC29067
hg38 Position: ChrY:7410614..7410614
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4a2
Comments: Downstream of A804.
Forward Primer: FGC29067_F GGGGTAGGGAAGAAAAGAAGG
Reverse Primer: FGC29067_R TATTGGGAAGGTCATGAAAAAGTC
Reviews

Customers who bought this product also purchased
FGC29072
FGC29072
FGC29071
FGC29071
FGC29077
FGC29077
FGC29069
FGC29069
FGC29076
FGC29076
FGC29066
FGC29066
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies