Top » Catalog » SNPs » FGC29069

$15.00

FGC29069
[FGC29069]

FGC29069
hg38 Position: ChrY:13676823..13676823
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Downstream of S1121.
Forward Primer: FGC29069_F AACATTCTCCAAGATAGACCATATGAG
Reverse Primer: FGC29069_R GTTTATTTGTTTGTTCACTTGTTTGAG
Reviews

Customers who bought this product also purchased
FGC29067
FGC29067
FGC29076
FGC29076
FGC29066
FGC29066
FGC29075
FGC29075
CTS8162
CTS8162
FGC29074
FGC29074
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies