Top » Catalog » SNPs » FGC29074

$15.00

FGC29074
[FGC29074]

FGC29074
hg38 Position: ChrY:17284646..17284646
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4a2
Comments: Downstream of A804.
Forward Primer: FGC29074_F CCAGCTGTGCTATATTTGATGC
Reverse Primer: FGC29074_R CAGAAACACGAGCACTGAGC
Reviews

Customers who bought this product also purchased
FGC29075
FGC29075
CTS8162
CTS8162
FGC29072
FGC29072
FGC29071
FGC29071
FGC29069
FGC29069
FGC29077
FGC29077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies