Top » Catalog » SNPs » FGC29075

$15.00

FGC29075
[FGC29075]

FGC29075
hg38 Position: ChrY:18942603..18942603
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Downstream of A804
Forward Primer: FGC29075v2_F CAGGCTTGGTGGTGCACA
Reverse Primer: FGC29075v2_R CTCATCTTGCTCTGTCACCG
Reviews

Customers who bought this product also purchased
CTS8162
CTS8162
FGC29072
FGC29072
FGC29071
FGC29071
FGC29069
FGC29069
FGC29077
FGC29077
FGC29067
FGC29067
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies