Top » Catalog » SNPs » FGC29076

$15.00

FGC29076
[FGC29076]

FGC29076
hg38 Position: ChrY:19606077..19606077
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4a2a
Comments: Downstream of S1121.
Forward Primer: FGC29076_F TAGTGGCAGGGGATTCCAAG
Reverse Primer: FGC29076_R TCTTTAGTTAACCTGAACGAAGTTG
Reviews

Customers who bought this product also purchased
FGC29069
FGC29069
FGC29077
FGC29077
FGC29067
FGC29067
FGC29075
FGC29075
FGC29066
FGC29066
FGC29074
FGC29074
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies