Top » Catalog » SNPs » FGC29077

$15.00

FGC29077
[FGC29077]

FGC29077
hg38 Position: ChrY:20751308..20751308
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Downstream of S1121.
Forward Primer: FGC29077_F TCCATGAAAGTGGTCTCTGC
Reverse Primer: FGC29077_R CCAGCTGTGATGTGTGGTG
Reviews

Customers who bought this product also purchased
FGC29071
FGC29071
FGC29069
FGC29069
FGC29076
FGC29076
FGC29067
FGC29067
FGC29075
FGC29075
FGC29066
FGC29066
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies