Top » Catalog » SNPs » A19243

$18.00

A19243
[A19243]

A19243
hg38 Position: ChrY:8440837..8440837
Ancestral: A
Derived: T
Reference: YSEQ (2017)
ISOGG Haplogroup: E1b1
Comments: Z1057 > CTS5856 > Z5017 > Z5016 > SK888 > S26015 > Z17107
Forward Primer: A19243_F AAGGAGGGAGTCGCTTAACTG
Reverse Primer: A19243_R TGGTATCATAAATCTTATCTTTGAAATGC
Reviews

Customers who bought this product also purchased
A19250
A19250
A19247
A19247
A19242
A19242
BY4425
BY4425
A19241
A19241
A19252
A19252
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies