Top » Catalog » SNPs » FGC11134

$18.00

FGC11134
[FGC11134]

FGC11134
hg38 Position: ChrY:19221580..19221580
Ancestral: T
Derived: A
Reference: Full Genomes Inc (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c
Comments: Downstream DF13 and upstream of CTS4466
Forward Primer: FGC11134_F TTATTAATAGCAAAGAATAATTGAAATCTCAC
Reverse Primer: FGC11134_R ATGCCAGGTGGCAACTTG
Reviews

Customers who bought this product also purchased
BY203693
BY203693
A178
A178
CTS2457
CTS2457
A2121
A2121
A194
A194
S1090
S1090
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies