Top » Catalog » SNPs » A2220

$18.00

A2220
[A2220]

A2220
hg38 Position: ChrY:14157724..14157724
Ancestral: C
Derived: A
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1a3
Comments: Found in CTS4466 samples. Downstream of Z16259.
Forward Primer: A2220_F TTTTTGGAGACAGGGTCTCAG
Reverse Primer: A2220_R TGGTGCAACCCTTAAGCAAC
Reviews

Customers who bought this product also purchased
A7660
A7660
A12017
A12017
DF13
DF13
L513
L513
A2295
A2295
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies