Top » Catalog » A252

$18.00

A252
[A252]

A252
hg38 Position: ChrY:16791788..16791788
Ancestral: T
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A252_F CAACCAACTCCAGTTTTGTAGC
Reverse Primer: A252_R GCATTTGTGCCATATTTAGCTG
Reviews

Customers who bought this product also purchased
A246
A246
R1b-Z251 downstream 24
R1b-Z251 downstream 24
A253
A253
A238
A238
FGC13909
FGC13909
A245
A245
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies