Top » Catalog » A293

$18.00

A293
[A293]

A293
hg38 Position: ChrY:14651374..14651374
Ancestral: A
Derived: C
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: .
Forward Primer: A293_F TATTTGGCCCTGTTCATTTG
Reverse Primer: A293_R GAAAATCCAAAAGGATGGTTG
Reviews

Customers who bought this product also purchased
A337
A337
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
A346
A346
A212
A212
A350
A350
A292
A292
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A100
1 x A2075
$36.00
Haplogroup Info
Other products
Currencies