Top » Catalog » A361

$18.00

A361
[A361]

A361
hg38 Position: ChrY:17230099..17230099
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A361_F CAGCTGGTAAATCCACTACAAGGT
Reverse Primer: A361_R TGCTCATTTCTAGGCATAGGCT
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies