Top » Catalog » Y15814

$18.00

Y15814
[Y15814]

Y15814
hg38 Position: ChrY:15640821..15640821
Ancestral: C
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: N1c (not listed)
Comments: Below VL29 > Y5004 > Y7297
Forward Primer: Y15814_F GGCAGATACTCAGCAGCTGG
Reverse Primer: Y15814_R AGGGGGAATGTATCTGTTTCCT
Reviews

Customers who bought this product also purchased
CTS9976
CTS9976
L550
L550
Y15615
Y15615
N1a-VL29 Panel
N1a-VL29 Panel
Y15812
Y15812
Y5005
Y5005
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies