Top » Catalog » A490

$18.00

A490
[A490]

A490
hg38 Position: ChrY:21163617..21163617
Ancestral: G
Derived: N
Reference: Tony Popish (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A490_F CTCTGGAGGTAGTGGGCAAC
Reverse Primer: A490_R GGGAGGGGTCTGTTTTTCTC
Reviews

Customers who bought this product also purchased
A487
A487
A484
A484
A481
A481
A483
A483
A491
A491
A480
A480
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies