Top » Catalog » A526

$18.00

A526
[A526]

A526
hg38 Position: ChrY:19680058..19680058
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A526_F ACTGGGAAGTAGCGGTTGTG
Reverse Primer: A526_R AGTGCCAGGCAGACTGTACC
Reviews

Customers who bought this product also purchased
A512
A512
A529
A529
A525
A525
A524
A524
A521
A521
A530
A530
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies