Top » Catalog » A566

$18.00

A566
[A566]

A566
hg38 Position: ChrY:16314401..16314401
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A566_F GAGGTGGGACAGTTATTCAAATC
Reverse Primer: A566_R TCTATAACCCAATGAATCAGCACTAC
Reviews

Customers who bought this product also purchased
A560
A560
A570
A570
A559
A559
A569
A569
R1b-FGC14877 downstream
R1b-FGC14877 downstream
A567
A567
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies